Monday, August 24, 2020
Why hotel firms choose to integrate both vertically and horizontally Essay
Why inn firms decide to incorporate both vertically and on a level plane inside the more extensive the travel industry - Essay Example The reason for a business is to get and keep a client. As lodging firms are powerfully advancing substances working inside a progressively developing condition, a few methods for assessment of the manner by which the two connect must be seen to empower them as better coordinated. So as to accomplish these objectives the travel industry and accommodation industry decide to coordinate both vertically and on a level plane to address the issues of their clients and accomplish by and large goals. It ought to be referenced that mix is advancement past the current item and market, yet at the same time inside the wide bounds of the 'industry' inside which the organization works: for instance, Sheraton and Crowne Plaza are enhanced partnerships, however practically the entirety of their inclinations are in the purchaser administration industry. Joining both vertical and even in this manner expands on the benefits or exercises which the firm has created in administration or market terms (Nebel, 1991). 1.1. Vertical mix. Vertical reconciliation is a more extensive term used to depict either in reverse or forward coordination. In reverse reconciliation is well known in the travel industry and neighborliness industry. It alludes to improvement into exercises which are worried about the contributions to the organization's present business (for example are further back in the worth framework). In reverse reconciliation is significant for the travel industry and accommodation industry since it alludes to improvement into exercises which are worried about an organization's yields (for example are further forward in the worth framework, for example, transport, circulation, fixes and overhauling (Powers, Barrows, 2002). 1.2. Even mix. Even mix alludes to improvement into exercises which are serious with, or straightforwardly correlative to, an organization's current exercises. A loaning library's augmentation into visitor data or video tape material would be a model (Stutts, 2001). The securing of, or merger with, a contender would be one method of accomplishing this, for instance. The key rationale behind level advancement is ordinarily to pick up influence or market control over providers or purchasers. Higher volume by and large gives more prominent scope economies in buying though bigger item piece of the overall industry presents more noteworthy estimating control over clients. 2. The job of vertical joining in friendliness and the travel industry In reverse vertical improvement is development towards a provider of assets utilized by the business. This may be an endeavor to make sure about gracefully of a secret weapon or to increase a cost advantage over contenders by 'securing' a provider. On the other hand, forward vertical advancement is development towards the following stage in the gracefully chain by increasing an enthusiasm for a purchaser of the organization's yields. In the two cases, the vital rationale is to make sure about an a dependable balance in a similar gracefully chain to ensure flexibly or appropriation. This level of vertical incorporation was uncommon in an industry which had become portrayed by master organizations focusing on only one of these jobs. The organization accepted the quality of its way of thinking was that one division could assist another when times got hard, as in the downturn of the mid 1990s. For instance, in spite of the fact that interest for low rate lodgings had declined, yet standa rd administrations had encountered solid. Subsequently, the low rate inns h
Saturday, August 22, 2020
Outline the key features of a sports development strategy, and discuss Essay
Blueprint the key highlights of a games advancement system, and talk about the significance this needs to contemporary games the board - Essay Example It is likewise a guide to great wellbeing. It opposes ailments and assists with improving the personal satisfaction. The economy of the vast majority of the nations relies on the games (Girginov, 2008). In the previous decade there has been a tremendous development in the games. The wellbeing and wellness division has extended itself to satisfy the need of competitors and athletes. Work in this area has been expanded because of the expanded polished methodology of the National Governing Bodies and enormous speculations by various associations. As this industry has prepared itself, the need of qualified and taught troughs has expanded. Since they could more readily comprehend the games showcase and cook its needs and could apply their expert information in a composed manner. A great many schools and universities have been built up to provide food the requirements of the games area (Trenberth and Hassan, 2011). The administration has been transformed into complexity and it is continually developing. Because of the worldwide idea of the games it needs to manage all sort of financial obstructions. Certain issues like sex connection, social duty and viciousness are to be truly tended to. These are a portion of the difficulties which the games administrators of today are confronting (Hassan and Lusted, 2013). Sports the board are the arrangement of abilities relating arranging sorting out, Leading, controlling and planning for an association whose principle duty is to provide food the administrations in the games. The games business has been sectioned into three fundamental classifications. Initial one is the Sports Performance. It incorporates the initiation and cooperation of the individuals identified with the games business and its partners. Second fragment is Sports Production which is identified with its items and effect on the items. The third division of the games business is the Sports Promotion which is the center of Sports Event Management. Distinctive promotion apparatuses are utilized to advance the game and cause it to acclimate
Saturday, July 25, 2020
Girl by Jamaica Kncaid Essay Sample
Girl by Jamaica Kncaid Essay Sample In 1978, Jamaica Kncaid wrote a great story that has a name âGirlâ. It was published in The New Yorker and became the first published piece of writing of this author. In 1983, this short fiction story was included in the collection called âAt the bottom of the riverâ. It became very popular in the past among different groups of people, like teenagers, African-Americans, and women. Nowadays, it is also very popular among people because it still discloses the important themes. The story âGirl, the same as other stories of the author, are based on the personal experience of this woman. The author is from Antigua, and such stories she wrote in order to present how it is to live as one of the colonies of Great Britain and as an independent stating having to deal with the after-effects of colonial rule. In her works, she speaks about discrimination, colonialism, the problem of AIDS that killed her brother, and other not less important problems that are related to the fact that she is a woman of African descent. This exact story deals with the experience of being a young woman, who live in a poor country. In general, this short story is a prose poem that reads like prose but still follows the conventional poetry rules. There are only two characters in the poem â" a mother and a daughter. The story âGirlâ is two pages long and consists of a dramatic monolog in which mother give advice to her daughter. It is very interesting that this prose poem is one long sentence that is separated by semi-colons. It is also easy to notice that it looks like a list of different commands about adult life. The advice given by the mother consists of how to do different domestic behaviors, like preparing Antiguan dishes, being a respectable woman, and upholding purity. Apart from this, there is a discussion how the daughter should communicate with the different people and how she should behave being in a romantic relationship with a man. Mostly, the story is a monolog of the mother because the daughter speaks only twice. The first time this has happened when she stands up for herself responding to on e of the motherâs questions, and the second time has happened at the end of the story when she asks the mother some clarifying question. The story finishes with a rhetorical question from the mother wondering if the daughter didnât understand how to communicate and behave with different people based on everything she was told. The story contains three main themes: domesticity, daughter and mother relationship, and sexual reputation. The mother strongly believes that knowledge of domesticity will help her to become a good member of the community. In general, the mother thinks that there are only two groups of women: the first one is the respectable women and the second one is âslutsâ. The question of sexuality is presented very well. Yet, it is presented from quite a negative side. The mother is afraid that her daughter wonât be a respectable woman and she tries to teach her everything, as she thinks, her daughter should know about the world and the society. The story also demonstrates that the mother criticizes the daughter: the way how she walks and relates to people. Therefore, it possible to say that the relationship between these two women isnât very close because they do not understand each other. The short story âGirlâ will not lose her popularity until the problems described there disappear. For this reason, it is a very good idea for every young person to read this prose poem, analyze it, and take into consideration the ideas included there.
Friday, May 22, 2020
Pepper Seed Dna Extraction - 2422 Words
Pepper Seed DNA Extraction Biochem lab: CHE 452L marisol gomez Pepper Seed DNA Extraction Biochem lab: CHE 452L marisol gomez 2015 2015 INTRODUCTION The jalapeno is a member of the capsicum family, along with many other peppers. The usual methods for characterization of different pepper species are based on their morphological and physiological traits, however this many not always be enough. For peppers, their traits are influenced by things like their genotype or their specific environment. Genomic markers can allow for a more direct comparison of closely related individuals (Ansari and Khan, 2012). In our case we focus on DNA extraction. The two basic parts of a DNA extraction procedure include the breaking of the cell wallsâ⬠¦show more contentâ⬠¦Reliable DNA analysis is also important in the management of wild life. In the case of Wedrowicz, the koala population is being threatened and the need for data on their genetic diversity is of extreme importance. However obtaining the DNA from the koala is not a simple task, this is due to cost, stress, and ethics of capturing a koala. Sometimes the only way to obtain a sample of DNA is by the collection of scats. This means that once the DNA sample is obtained it must be rushed to the lab for extraction while the sample is still fresh. Obtaining this DNA can allow for analysis of population, breeding, and habitat of not only koalas, but of many other mammals (Wedrowicz, Faye, 2013). MATERIALS AND METHODS Plant Materials Seeds from different capsicum plants were purchased locally. The pepper seeds collected were ââ¬ËJapanese chiliââ¬â¢, ââ¬ËCalifornia Bellââ¬â¢, ââ¬ËSerranoââ¬â¢, ââ¬ËHabaneroââ¬â¢, and ââ¬ËJalapenoââ¬â¢. Chemicals and Reagents The chemical and reagents used for the extraction and quantitation of DNA were: Plant DNAzol (0.3ml/0.1g), 100% ethanol (100%: 0.225 ml/0.1 g, 75%: 0.3 ml/0.1 g), Chloroform (0.3 ml/0.1 g), Plant DNAzol-ethanol solution: Plant DNAzol, 100% ethanol (1:0.75 v/v), TE buffer (10 mM Tris, 1 mM EDTA pH 8.0), 1.2% agarose gel (Agarose, 1X TAE buffer), 6X loading buffer (glycerol, Tris/EDTA pH 8.0, ethidium bromide), .25X TAE buffer, Restriction enzymes and Restriction endonuclease buffers. All the chemicals used were quality grade. The restrictionShow MoreRelatedGenetic Engineering And Its Effect On Human Health1996 Words à |à 8 PagesIntroduction Genetically modified crops also known as GMCs, GM crops or biotech crops, are plants, which DNA has been modified using genetic engineering techniques. In most cases the goal is to introduce a new trait to the plant, which does not occur naturally in the species, for examples in crops and food. Since 1960, there are many introducing genetic engineering in crops production as it can bring a lot of benefits e.g. increasing food production, it is also environmental friendly and it givesRead MoreThe Process Of Genetic Engineering2336 Words à |à 10 Pageslist-------------------------------------------------------------------------------------------------------------- Introduction Genetically modified crops also known, as GMCs, GM crops, or biotech crops, genetic modified crops are plants used in agriculture, the DNA of which has been modified using genetic engineering techniques. In most events the goal is to introduce a new trait to the plant, which does not occur naturally in the species, for examples in crops and food. Since from 1960, there are many countriesRead MorePharmacological And Ethnobotanical Review Of Aristolochia Bracteolata L4386 Words à |à 18 PagesKida-mari, Ethnomedicines. Introduction Plant Perennial scandent shrubs, leaves raniform or ovate, usually obtuse, cordate at the base with a wide shallow sinous. Flowers solitary, dark purple. Capsules oblong, ellipsoid, and 12- ribbed, glabrous. Seeds deltoid, with slightly cordate base. Slender, decumbent, glabrous, perennial herbs, woody at base. Leaves broadly ovate or reniform, 3-6 x 4.5-8 cm, glaucous below. Flowers dark purple, axillary, solitary. Capsules oblong-ellipsoid, 1.5-2.2 x 1-1.5Read MoreSexually Transmitted Diseases35655 Words à |à 143 Pages 114-128 Unit 6 Living things in the Environment Plant and animal cells 129 Eukaryotes vs prokaryotes 130 Structures and functions 133-137 Microbes 148-150 Onion and cheek cells 150-151 Ecological study 154 Seed structure and germination 155-157 Reproduction in plants 158-165 Sexually transmitted diseases 166-176 Birth Control and contraceptives 177-185 Effects on population growth 186-187 Drug and drug abuse 188-191 Manââ¬â¢s impact
Friday, May 8, 2020
Role Of The President And Congress During The Economy Essay
Introduction The economic conditions prevailing in a country impact heavily on local businesses and organization. Depending on how well prepares an organization is prepared to handle the economic changes that occur, the organization can either thrive in business or collapse. There is more to this picture. An individual organization cannot shield itself enough against harsh economic tides. Thus, the government has to create checks and balances to bring about a stable and sustainable economic environment so as to spur a steady economic growth for local businesses and firms to thrive. Role of the President and Congress in the Economy The President works hand in hand with congress to make policies that either stimulate or contract the economy.Such policies may be made to either increase or reduce government spending on such sectors as defense, in terms of military spending, health, education and other sectors. Primarily, the government must spend in order to develop infrastructure, provide basic services to the people as well as enforce laws and contracts on the land (Mitchell, 2005). Without such expenditure, there would be little, if any, economic progress. However, a balance must be maintained to ensure that this expenditure does not exceed what the nation can afford. The government must, therefore, ââ¬Å"live within its means.â⬠With increased spending, the government tends to increase taxes in order to meet the cost. This in reverse, threatens productivity among theShow MoreRelated Congress Essay1734 Words à |à 7 Pagesfor Congress in the United State s. It serves many roles such as making laws, implementing national policy and watching over the other two branches of government. These are just a few of the duties of our U.S. Congress. Although they are essential to our government, there are potential problems. People are not always satisfied with the length of time involved in passing a law as well as the deadlock Congress can experience on an issue. Another potential problem people see with Congress is representationRead MoreResponsibilities Of The Founding Fathers Of Our Constitution861 Words à |à 4 Pagesduties and responsibilities of the President of the United States. There are several major ââ¬Å"hatsâ⬠that the President is required to wear during their term of office. Those duties are as follows: Chief of State, Roles Related to Foreign Affairs, Commander and Chief, Chief Administrator, Chief Legislator, Party Leader, National Opinion Leader and Manager of the Economy(Pearson Education, Inc.Volkomer, Walter E.Copyright 2013). The bulk of the powers of the President are mainly found in Article II,Read MoreEssay On Foreign Policy1109 Words à |à 5 Pagestheir ideologies and manifesto to the citizens. Therefore, before the United States gets a new president, media [online media, newspapers, television, radio, and magazines] play a major role in making the candidate known both at local and international levels. After a successful election, the presiden t elect is then inaugurated on January 20th, takes the Oath of Office to the high office of the president. The constitutional framers believed in presidency, this led them to the creation of an officeRead MoreThe President As Chief Legislator1035 Words à |à 5 PagesThe President as Chief Legislator When a president is sworn into office, he or she takes on a multitude of titles. One of the many titles the president is issued is the role of Chief in Legislator. This means that the president plays a crucial part in the legislative process or lawmaking. This title holds much authority in the eyes of Americans (Hoffman Howard, 1317). Though this title does not give the president absolute authority, it does grant him or her strong jurisdiction in the legislatureRead MorePublic Policy Is An Essential Element Of The United States Government977 Words à |à 4 Pagesgovernment. Congress, the president, the Cabinet, as well as the thousands members of the bureaucracy, all play a crucial role in defining how political decision are made in the United States. Public policy not only shapes the national government, but it also shapes the state and local governments as well. Domestic, foreign, and economic policies are come together to form public policy as a whole and all deal with differen t issues and problems of the country. However, both the president and Congress bothRead MoreForeign Policy : An Overview Of Major Trends Essay1242 Words à |à 5 Pagesa stronger world economy system. As history put it, ââ¬Å" Morocco was the first Muslim country to formally deals with the United States as represented by the Moroccan ââ¬â American treaty of friendship in 1786â⬠. Now the foreign policy of Barack Obama has been the policy of the United States since the Obama administration was inauguration in January of 2009. Since then Congress and President Obama are working on the shared power of foreign policy. The role of the President and Congress in foreign policy:Read MoreAndrew Jackson s Views On The Election Of 18241483 Words à |à 6 Pagesof the people. When Adamââ¬â¢s administration continued to favor a strong federal role in economic development, Jacksonians denounced their political enemies as using government favors to reward their friends and economic elites. By contrast, Jackson presented himself as a champion of the common man and by doing so helped lead himself into victory in the election of 1828. A man of the people would now govern the nation. During Jacksonââ¬â¢s two terms in office, he created tensions between the North and SouthRead MoreWhat Did The End Of The Reconstruction Happened?1046 Words à |à 5 PagesHistory 9 January 2017 Rutherford B. Hayes Who is Rutherford B. Hayes? What did he do while in office? How well did he work with congress? How well did he work with foreign countries? How well did he help the American people? Did he keep the economy ordered and organized? Hayes was the 19th President of the United States, he only served one term as president from 1877 to 1881. He was involved in the ending of the reconstruction, the Dawes Act, The Great Railroad Strike, Colombia and the MonroeRead MorePresident Truman And Lyndon B. Johnson1605 Words à |à 7 Pagesnot, the first 100 days of a president continue to be much examined topic. President Franklin D. Roosevelt had an unprecedented first 100 days and every president since then has been measured against the effectiveness of FDR. For the purpose of this analytical essay Presidents Harry Truman and Lyndon B. Johnson will be examined in comparison with FDR. Truman and Johnson were not initially elected as president, but stepped in the finish the term of the ele cted presidents who had died in office, FDRRead MoreDemocrats and Republicans in the US Congress are as ideologically consistent and distinct as they1500 Words à |à 6 Pagesthe US Congress are as ideologically consistent and distinct as they have been at any point. Both houses in the US congress have become more ideologically polarized in the past few years. Parties have grown increasingly divided in the past years on all major policy dimensions in American politics, Democrats have become more liberal and Republicans have become more conservative and independents are also leaning towards sides now a days. In fact, I believe that political polarization in congress was at
Wednesday, May 6, 2020
Forecast of Aud/Usd Free Essays
In short term, Australia is facing higher inflation rate (2. 9%) than the United States (2. 1%), this can lead to the domestic market price increase but not much fluctuation for currency exchange rate. We will write a custom essay sample on Forecast of Aud/Usd: or any similar topic only for you Order Now Moreover, Australia has higher GDP growth rate than United States (3. 5% vs 2. 4%) and lower unemployment rate than US, which are 5. 2% and 7. 9% in 2013. Therefore, the income will increase in Australia. Australia consumers would spend more on the US imports and the demand for US will increase. The supply of dollars will increase to buy more US products and the value of USD will increase relative to the AUD. In conclusion, we predict that the exchange rate of AUD/USD will decrease in the short term. In intermediate term, there will be almost a constant decline of inflation rate each year in Australia while that of United States remains fairly constant. The Inflation rate in United States is still lower than Australia. As a result, it is highly unlikely that the interest rate in Australia will increase by a large amount. On the other hand, the interest rate within the United States would be expected to remain quite low. In addition, according to the information from IMF, GDP growth of Australia will be stable at 3. 5% while that of United States will increase from 2. 4% to 3. 5%. Although there is a large reduction in unemployment rate in United States, it is still higher than Australiaââ¬â¢s. Therefore, as long as the US Federal Reserve will not implement the monetary policy QE3 in the next few years, the currency of the United States will go up against Australia, but exchange rate of Australia will still be slightly higher than United States in the intermediate term. In the long term (greater than 5 years), the inflation rate of Australia will drop to 2. 4% in 2017 while that of United States will start to rise. On the other hand, GDP growth for both Australia and United States are similar at a stable pace of 4% and are hard to improve?In addition, the unemployment rate will continue to decline to about 4%. After 2017, inflation rates and GDP growth rate of both countries are expected to get closer and closer, achieving the stable coordination finally. At the same time, the Central Banks should not raise their interest rate to lower the inflation. Therefore, in conclusion, we predict that the exchange rate of AUD/USD will remain at a stable relationship with each other in the long term. Reference: IMF 2012, IMF Data Mapper, 2Executive summary This report focuses on forecasting the trend of exchange rate of AUD/USD and PHP/USD in short term, intermediate term and long term. The fundamental analysis is based on the changes in demand and supply of those three currencies. In terms of PHP/USD, for short term, the higher domestic interest rate in Philippine and the monetary policy (QE) will be implemented by United States will result in PHP/USD decreases. For intermediate term, as QE grows the GDP of United States, Philippines remain domestic policies and target, the supply of dollars increase faster than demand of pesos decrease, PHP/USD continue to decrease. For long term, those factors which affect the exchange rate will trend to reach an another equilibrium, PHP/USD increase. As for AUD/USD, due to the increased consumption of Australia on the US imports, the demand for US will increase. Consequently, AUD/USD will decrease in the short term. For intermediate term, Unit Stated will experience an obvious economic recovery while the major macroeconomic variables in Australia generally remain at a stable level, thus AUD/USD will continuous fall, but AUD will still appreciate slightly against USD. In the long term, the economy of both countries are expected to get a stable coordination, so it is likely that the USD will stop depreciating against the AUD and the exchange rate between the USD and he AUD achieve an new equilibrium. In recommendation, US dollar trend to depreciate against Philippines peso in short and intermediate term, purchasing pesos using US dollars now and exchange back to US dollar in the future which up to 5 years for gaining profit. US dollar trend to be appreciated against AU dollar in short and intermediate term, hence the top manager should hold a short position on the AUD and a long position on the USD, while for the long term the top manager just hold a short position on the USD. How to cite Forecast of Aud/Usd:, Papers
Forecast of Aud/Usd Free Essays
In short term, Australia is facing higher inflation rate (2. 9%) than the United States (2. 1%), this can lead to the domestic market price increase but not much fluctuation for currency exchange rate. We will write a custom essay sample on Forecast of Aud/Usd: or any similar topic only for you Order Now Moreover, Australia has higher GDP growth rate than United States (3. 5% vs 2. 4%) and lower unemployment rate than US, which are 5. 2% and 7. 9% in 2013. Therefore, the income will increase in Australia. Australia consumers would spend more on the US imports and the demand for US will increase. The supply of dollars will increase to buy more US products and the value of USD will increase relative to the AUD. In conclusion, we predict that the exchange rate of AUD/USD will decrease in the short term. In intermediate term, there will be almost a constant decline of inflation rate each year in Australia while that of United States remains fairly constant. The Inflation rate in United States is still lower than Australia. As a result, it is highly unlikely that the interest rate in Australia will increase by a large amount. On the other hand, the interest rate within the United States would be expected to remain quite low. In addition, according to the information from IMF, GDP growth of Australia will be stable at 3. 5% while that of United States will increase from 2. 4% to 3. 5%. Although there is a large reduction in unemployment rate in United States, it is still higher than Australiaââ¬â¢s. Therefore, as long as the US Federal Reserve will not implement the monetary policy QE3 in the next few years, the currency of the United States will go up against Australia, but exchange rate of Australia will still be slightly higher than United States in the intermediate term. In the long term (greater than 5 years), the inflation rate of Australia will drop to 2. 4% in 2017 while that of United States will start to rise. On the other hand, GDP growth for both Australia and United States are similar at a stable pace of 4% and are hard to improve?In addition, the unemployment rate will continue to decline to about 4%. After 2017, inflation rates and GDP growth rate of both countries are expected to get closer and closer, achieving the stable coordination finally. At the same time, the Central Banks should not raise their interest rate to lower the inflation. Therefore, in conclusion, we predict that the exchange rate of AUD/USD will remain at a stable relationship with each other in the long term. Reference: IMF 2012, IMF Data Mapper, 2Executive summary This report focuses on forecasting the trend of exchange rate of AUD/USD and PHP/USD in short term, intermediate term and long term. The fundamental analysis is based on the changes in demand and supply of those three currencies. In terms of PHP/USD, for short term, the higher domestic interest rate in Philippine and the monetary policy (QE) will be implemented by United States will result in PHP/USD decreases. For intermediate term, as QE grows the GDP of United States, Philippines remain domestic policies and target, the supply of dollars increase faster than demand of pesos decrease, PHP/USD continue to decrease. For long term, those factors which affect the exchange rate will trend to reach an another equilibrium, PHP/USD increase. As for AUD/USD, due to the increased consumption of Australia on the US imports, the demand for US will increase. Consequently, AUD/USD will decrease in the short term. For intermediate term, Unit Stated will experience an obvious economic recovery while the major macroeconomic variables in Australia generally remain at a stable level, thus AUD/USD will continuous fall, but AUD will still appreciate slightly against USD. In the long term, the economy of both countries are expected to get a stable coordination, so it is likely that the USD will stop depreciating against the AUD and the exchange rate between the USD and he AUD achieve an new equilibrium. In recommendation, US dollar trend to depreciate against Philippines peso in short and intermediate term, purchasing pesos using US dollars now and exchange back to US dollar in the future which up to 5 years for gaining profit. US dollar trend to be appreciated against AU dollar in short and intermediate term, hence the top manager should hold a short position on the AUD and a long position on the USD, while for the long term the top manager just hold a short position on the USD. How to cite Forecast of Aud/Usd:, Papers
Monday, April 27, 2020
Supply Demand Curve In The Airline Industry Tourism Essay Essay Example
Supply Demand Curve In The Airline Industry Tourism Essay Paper Airline industry provides us air transit that improves our lives by shortening the clip it takes us to make a finish and besides present goods. Airline industry undergoes oligopoly market, where merely a few Sellerss that provide similar merchandises or services but differentiated in the stigmatization and the publicity method. Basically, there are four chief classs in the air hose industry, which is international, national, regional, and lading. International flights supply services between states ; both national and regional flights are domestic flights within a state, but regional flights have shorter distance comparison to national flights ; lading is chiefly for the usage of conveyance goods. In this assignment, we are traveling to briefly explicate the determiners and the alterations in market status that affect the demand and supply of the air hose industry. We will write a custom essay sample on Supply Demand Curve In The Airline Industry Tourism Essay specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Supply Demand Curve In The Airline Industry Tourism Essay specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Supply Demand Curve In The Airline Industry Tourism Essay specifically for you FOR ONLY $16.38 $13.9/page Hire Writer There are few determiners that will do a alteration in the supply demand curve in the air hose industry. Determinants on demand curve. The first determiner is income. When a state experiences a growing in the economic system, the mean income of citizens will increase. In this instance, air ticket plays a function as a normal good, this is because an addition in the income will take to an addition in the demand of air ticket purchased, one illustration is households might go more frequently as they are in good economic status. The 2nd determiner is monetary values of related goods, where a alteration in monetary value of a good might impact the demand of the other good. In the air hose industry, the monetary value of fuel has a direct influence to the demand of air ticket. When the monetary value of fuel additions, air hose industry has to increase the monetary value of air ticket to keep its gross. Therefore, the fuel monetary value and the demand of air ticket have a relationship of complements, where addition in the fuel monetary value leads to a lessening in the demand for air ticket. However, in some particular instances particularly during a diminution in the economic system, the air hose industry will non raise the monetary value of air tickets because the clients would frighten off. Therefore, the demand of air tickets is besides rather dependent to the status of economic system. The 3rd determiner is figure of purchasers. The more the purchasers in the air hose industry, the demand of air ticket will be higher. When a publicity is held by the industry air hoses, there will be more purchasers on the purchase of air ticket. This is because the air tickets usually sell at a lower monetary value to pull more clients particularly during a not-so-peak season. Therefore, the demand or air tickets will increase and the air hose industry will derive more net incomes even though the air tickets are selling at a lower monetary value. The last determiner is outlook on future income and future monetary value, which means the anticipation of consumers on how much they will gain and the value of a good in the hereafter. For illustration, if the economic system has a positive development, where people expect a higher income in the hereafter, they might travel for a holiday and switch the demand curve of air ticket to the right. However, if they realize there will be an addition in monetary value of air ticket in the hereafter likely due to top out season, they will take to buy now so later and do the demand curve to switch to the right. For the other variable like gustatory sensations that can impact demand curve, we will disregard it because it is based on personal behaviour and is unsure to the air hose industry. Determinants on supply curve. The first determiner is input monetary values. When the cost of bring forthing goods additions, the supply will diminish. In air hose industry, one of the chief input monetary values is the fuel monetary value. As other variables are changeless, when the monetary value of fuel additions, the figure of flight per twenty-four hours will diminish to cut down the cost of air hose industry. The 2nd determiner is engineering. A better engineering can switch the supply curve to the right. Technology promotion plays a really of import function in air hose industry. Airline industry is seeking their best to seek for better engineering in fuel preservation. Besides, they besides work with airframe and engine maker in planing the constituents of aircraft to cut down the fuel ingestion of each flight. Therefore, with the betterment of engineering, air hoses can supply more flight so before utilizing the same sum of fuel. The 3rd determiner is weather. As this is air transit, weather frequently becomes a large issue to the air hose industry. A heavy snow during winter, or a bad pollution, frequently disrupts the takeoff and landing of aircraft. Unfortunately, conditions is non control by worlds, the air hose industry merely can make their best in supplying complete and safety installations to protect their users. Although bad conditions does non last really long, it does convey some consequence on flight for short periods. The last determiner is outlook on future monetary value. When a house expects there is a rise of monetary value in future, they will provide less today until the monetary value of the merchandise addition. In the air hose industry, when they expect the monetary value of air ticket to lift in the coming extremum season that brings higher net incomes, they will cut down or keep the figure of flights now. Therefore, when comparing the figure of flights for two periods, the supply for now can said to be less comparison to future. Since air hose industry undergoes the oligopoly market, the determiner of figure of Sellerss will be excluded. Other variables like revenue enhancements and subsidies will besides be excluded as they are non unsure. Decision As we can see from above, air hose industry has to concern many determiners that can impact the air hoses demand and supply. Besides, they have to detect carefully on the alterations in market status and take immediate action if there is any unexpected issue. Harmonizing to the Air Transport Association ( ATA ) , labour is the largest disbursals of the air hose industry, followed by fuel cost. Other variables like conditions and engineering besides have to set good attending to guarantee the safety and gross of the air hose industry. The survey of economic sciences may assist the air hose industry when doing a determination and better pick by supplying cognition on the efficiency usage of resources.
Thursday, March 19, 2020
buy custom Validity essay
buy custom Validity essay Validity is the level of accuracy in measurement of a concept during a study or research. It is concerned with the aptness, and convenience of the exact deductions made from test scores. Validity has been viewed conventionally through various forms related to content, criterion as well as that which is concerned with constructs a proof among others. However, there are current paradigms that take validity as a unitary concept (Cook, 2005). As a result, test proofs should be got from various sources to support an interpretation. If consideration to the orderly assortment of validity evidence is improved, evaluations in psychometric tests will be improved. When a test score and the quality being measured are in conformity, then validity is said to be achieved. The usefulness of a test score can only be achieved by having definite evidence got through definite means (Marakas, Johnson, Clay, 2007). Besides, test values should have validity for the purpose intended. There are rules of evidence that psychologists abide to, as a way of ascertaining that a test score has a meaning for a specific reason. Therefore, to attain validity, the level of deductions from test findings should be reasonable, appropriate and significant (Saccuzzo Kaplan, 2008). At initial stages of data collection in any given study, there is usually no reason to consider a test score valid. However, evidence for validity of a test score is attained through correlation between the test values and other variables in the study. Just like in a court scenario where evidence of guilt is expected to be convincing, evidence is required to show the validity of the test and even establish a connection between two or more variables being considered (Cook, 2005). It is worth mentioning that validity is not a property attached to the apparatus used in a study, but instead, to the results and interpretations of the apparatus. This means that same instrument can be used to measure different variables with different interpretations. Since validity is concerned with deductions, not the apparatus used, it should be well founded for every intended explanation (Cohen, Fu, Fu, 2008). It would be wrong to consider the validity as a concept, since it implies that it can only be found at two extremes. First, validity is attached to the deductions from measurements of an instrument which are reflected as levels of accuracy but not perfect values. The idea of validity is similar to a hypothesis (Cook, 2005). First, researchers states their hypothesis, thereafter, they gather enough proof to support the appropriateness of their arguments. Similarly, validity requires information that helps to proof and link the interpreted test values to heoretical information behind a specific study and the preferred interpretation. Nevertheless, validity cannot be proven since it is only expressed as a degree of appropriateness (Cook, 2005). The new unitary approach to validity has created some paradigms in this phenomenon. All validity should be grouped under a single structure of construct validity. This unique approach highlights that test scores obtained from an instrument are helpful when they signify a construct. At the same time, enough proof is needed to support the correlation between the two. The other forms of validity are then regarded as sources of validity proof in support of the general framework (Cook, 2005). There is no such big difference between the categories of validity, since all of them overlap. They also collectively support deductions made from the test values on construct validity. Content evidence entails steps of analyzing the correlation between the content of a test and the construct that a researcher aims to measure (Cook, 2005). The content ought to reflect the utter truth in order to obtain the intended information. The process involves scrutiny of the instrument intended to be used, development of chosen items to act as values for the information needed and qualification of the human resource used (Marakas, Johnson, Clay, 2007). Detailed description of all these steps is broadly grouped as the content evidence, and they assist in signifying the construct. Response process is an important process that helps to review, thereby shedding some light on the relationship between the construct and nature of details given by researchers (Cook, 2005). For instance, a tutor might inquire if students taking a test that involves measuring the diagnostic reasoning, whether, they invoked high-order thinking procedure. Additionally, if one of the necessities of an instrument used requires students to assess the performance of one another, evidence from the responses would suggest that the experimenters were well trained. Lastly, this category further incorporates data collection and security methods (Cohen, Fu, Fu, 2008). Existence of a relationship with test scores from another instrument where existence of a connection is found or not supports an explanation that is reliable to the fundamental construct. For instance, in order to get quality in life assessment, variations in values among patients with unstable health states would support validity (Cook, 2005). Analysis of results of an evaluation can express and even unearth any possible sources of invalidity. For instance, a test can be carried out to determine the rating levels of teachers in a certain school. If the assessment indicates that male tteachers are rated lower than their female counterparts, it could translate to a number of inferences (Cook, 2005). First, results are ambiguous. Second, the information implies that male teachers are not as effective as their female folks. In such a scenario, proof of the results is important to link test scores to the original construct before the proof can influence the validity of the deductions (Saccuzzo Kaplan, 2008). Moreover, evidence of results can still be evaluated by finding out whether what was expected from the assessment was achieved, and the unplanned effects were evaded. Therefore, if a faculty of higher authority excluded the teachers with lower test scores, the unexpected negative results would definitely affect the meaning of the score values and hence their validity (Saccuzzo Kaplan, 2008). On the contrary, if the remedy was provided and the low value of performance improves, the proof would support the validity of the interpretations. This is a clear indication of the controversial aspect of proof of consequences as far as a validity level is concerned. If the provided proof does not hold up to the original argument of validity, the argument can be declined or improved by fine-tuning the measurement process. The new argument is then re-evaluated once more. Validity is thus seen like a cyclic process of testing and revision. Nevertheless, the amount of evidence needed will depend on the anticipated uses of the instrument (Cook, 2005). Situations that require a high level of confidence in the accuracy of explanations will need more proof than situations that need lower levels of confidence for similar explanations. In addition, integration of the various sources of evidence will imply that some instruments used in measurement will depend more on some categories of validity evidence than others. Integration of categories of validity into one single framework implies that gathering of evidence requires employment of insight and careful planning. Researchers should use the sources of validity evidence as a basic framework when assessing instruments (Saccuzzo Kaplan, 2008). Conclusion Validity is concerned with the level at which test values reflect the underlying construct as well as the explanation of the results according to evidence provided. However, it does not relate to the instrument of measurement itself (Cook, 2005). A precise understanding of validity in psychometric tests and other evaluations helps the professionals in these fields a great deal. Consequently, enhancement of the consideration given to systematic gathering and appraisal of validity evidence will translate to development in research, learning and health care. Buy custom Validity essay
Tuesday, March 3, 2020
Every IB Business and Management Past Paper Available FREE and Official
Every IB Business and Management Past Paper Available FREE and Official SAT / ACT Prep Online Guides and Tips If you want to do well on your IB exams (which you should since acing them will get you college credits), you need to prepare like you would for any standardized test such as the PSAT, SAT or ACT, with practice tests. Preparing for the IB exams doesn't simply mean reviewing your class notes. You should use IB Business and Management past papers as practice tests so that you feel prepared for the length, format, and types of questions asked. In this article, I'll provide you with links to IB Business and Management past papers, free and official. Additionally, I'll give advice on how to use them to ace your real IB test. Free IB Business and Management Past Papers Links The IB has cracked down on illegally uploaded real past papers in the last few years, so many previous sources are no longer available. Compounding this problem, IB so far has not provided any free sample IB Business and Management exam papers on its website. We'll be sure to update this article as soon as they do with links, though! While searching for "free IB Business and Management papers" online may still turn up some results, we do not recommend using them, as there's no guarantee those papers are real past IB papers. Instead, we recommend using the relatively inexpensive official paid IB past papers and markschemes for further practice. Paid IB Business and Management Past Papers Links To download safe and official IB Business and Management SL/HL past papers and markschemes, purchase them from the Follet IBO store directly. Currently, the IBO store has two sets of English-language IB Business and Management SL past papers and IB Business and Management HL past papers in the new, 2016-exam format: one set from May 2017 and one from November 2016. (There are a small number of past IB Business Management papers in French and Spanish available on the store as well.) Note: The IBO sells each paper and mark scheme individually (boo); an individual paper or mark scheme costs $3 (or about à £2.50). This means a full test (with all papers and mark schemes) will cost about $12. Buying everything on the site from 2015 to 2017 will be costly (not to mention in different languages), so we recommend you only buy the two most recent (November 2016 and May 2017) past papers. These past papers will be the most similar to your test, and two exams will provide plenty of practice. How to Use These Exams An IB Business and Management test will take you 3 hours for SL or 4.5 hours for HL. If you are going to invest that much time, you need to be maximizing your learning from these tests. To make sure you get the most out of each practice test, follow these rules: #1: Split the Test Over Two Days In May 2019, the IBO scheduled Paper 1 and Papers 2 on two separate days before and after a weekend. If possible, you should copy this schedule exactly so that your practice is realistic. At the very least, make sure you are taking the two papers on two different days. Having to hold on to the information over multiple days (with a weekend in-between!) makes it difficult to cram for this test. You need to have mastered the IB Business and Management concepts and be able to write intelligently about them. #2: Use Exact Timing. Make sure you time yourself so that you force yourself to practice your pacing. The time allowed per paper is: Business and Management SL Paper 1- 1 hour 15 minutes Paper 2- 1 hour 45 minutes Business and Management HL Paper 1- 2 hours 15 minutes Paper 2- 2 hours 15 minutes Do not stray from this timing, not even by a minute. You need to get used to the actual exam timing. Also, youââ¬â¢ll get an inflated practice exam score if you allow yourself extra time. Donââ¬â¢t do it! Stick to the real timing so that you have a realistic indicator of your IB score. #3 (and the most important): Review! After completing all papers, review your exam with the mark scheme. Why do you need to review? Reviewing helps you figure out what mistakes you are making or what information you do not know before you take the real IB Business and Management exam. If you donââ¬â¢t check your answers, youââ¬â¢ll make the same mistakes on the actual IB Business and Management test. Take some time (at minimum an hour) to review your answers. Taking one practice test with in-depth review is far superior to taking 8 tests without review. Whatââ¬â¢s Next? Learn more about IB Business and Management and related topics: IB Business and Management Study Guide Return on Assets: What It Is and How to Use It Check out where to find past papers for your other classes: Every IB Biology Past Paper Available: Free and Official Where to Find IB Chemistry Past Papers - Free and Official Every IB Economics Past Paper Available: Free and Official Every IB English Past Paper Available: Free and Official Every IB Geography Past Paper Available: Free and Official Every IB History Past Paper Available: Free and Official Every IB Math Past Paper Available: Free and Official Where to Find IB Physics Past Papers - Free and Official Want to improve your SAT score by 160 points or your ACT score by 4 points? We've written a guide for each test about the top 5 strategies you must be using to have a shot at improving your score. Download it for free now:
Saturday, February 15, 2020
What do banks really do Essay Example | Topics and Well Written Essays - 4000 words
What do banks really do - Essay Example Commercial banks are financial institutions that provide loans, savings and deposits accounts as well as transactional services to entities and individual members of a country. On the other hand, Central Bank is a supreme monetary bank in any country, which regulates and controls economic as well as monetary affairs in a specific country. Central Banks regulates money supply via specific monetary and non-monetary policies to maintain stable and robust macroeconomic environment. This is in order to enhance sustained economic growth and development across different sectors in the economy. Central banks and commercial banks play distinct roles in the economy. In general, the central banks supervise all financial institutions including commercial banks and advices government on what policy action to pursue to maintain robust and stable macro economic environment. Commercial banks provide both monetary and non-monetary services to members of the public and different entities (companies, s ocieties and institutions). To understand the roles of banks in any given country, it is important to state and explain the different roles that different banks play. Therefore, this discussion is divided into two main parts. The first part describes the roles of central banks in any given economy and the second part describes the roles of commercial banks.... They are the only banks with legal mandate to create and issue currencies inform of notes and coins. Central banks are responsible for regulating quantity of all notes and coins issued. They also protect internal and external value of national currency (Backhaus, 2005). Before the central banks issue notes and coins, it must fulfill certain requirements to avoid inflation, currency devaluations and shortage of money in the economy among others. For example, it must keep reserves against all the coins and notes issued at any given time. As a sole issuer of legal tender, central banks easily control credit creation, maintain confidence of the people because it has government backing and recognition, and ensure that all currencies issued are uniform and acceptable. Secondly, central banks act as a bank, an agent and an advisor of banks as well as other financial institutions. Central banks act as lender of last resort. This happens when commercial banks fail to secure loans or advances from other financial institutions to run it banking operations. IMF (2008) asserts that central banks provide funding to financial institutions as lender of last resort to restore confidence in the banking system and avoid fire sales of banks assets by providing liquidity to financial institutions. Central banks also act as custodians and clearing agent for commercial banks. Central bank collects statistical information regularly on matters touching money, public debt, inflation, foreign exchange, trade policies, government securities as well as banking among other information. The information collected and analysed by central banks is disseminated to relevant financial institutions to assist them make informed choices on what strategies to
Sunday, February 2, 2020
Experiential Exercise Case Study Example | Topics and Well Written Essays - 500 words
Experiential Exercise - Case Study Example This happened due to several reasons. The most important reason behind this was the switch of female employees to other organizations. When Metropolitan Hospital founded Task Force on Retention and Advancement of Female Executive Positions, it identified three main causes for leaving by female workers: Answer: Duncan Green (2014) has highlighted many benefits of addressing the underlying problems of organizational diversity issues. The changes addressed the underlying problems in a very effective and professional way. Among the three main causes for leaving of Metropolitan Hospital by female workers, the first two were so much important for Metropolitan Hospital and these problems were directly linked with the operations of Metropolitan Hospital. So they ran a retooling program to address these top two concerns. They provided proper guidance, attention and growth prospects to both males and females. In addition to addressing the first two problems, Metropolitan Hospital also tried to solve the third problem that was more linked with the personal lives of the women rather than the professional lives. Metropolitan Hospital offered flexible work time, reduced workloads, and flexible work arrangements to address the family issues and engagements of women. All these restructuring of di versity program delivered good results after some time. Answer: There are certain attributes and functions that are required by managers to successfully implement a diversity program. Department of the Interior Diversity and Inclusion Strategic Plan (2012) highlights the following priorities and actions required by managers to successfully implement a diversity program: Mangers should run a competitive recruitment process comprising on qualified and experienced group of potential candidates. This principle is important to get high performing workforce drawn from all segments of society Cultivate the seed of an organizational culture in which
Saturday, January 25, 2020
Isolation in Death of a Salesman
Isolation in Death of a Salesman Arthur Millers play Death of a Salesman is the story of a man, Willy Loman, gone deaf to the outside world. Though many try to help him, he shuts them out and creates his own reality in which he is successful and loved by everyone. In Death of a Salesman, Willy has many influences both good and bad attempting to direct his life; it is his refusal to choose the helpful advice that will ultimately lead to his downfall. One negative influence in Willys life is the inability of his friends to confront him about his problems. It is Willys wife that causes him the most harm. In her vain attempt to protect Willy, she actually allows his eventual death. The first sign of her negligence comes in one of Willys flashbacks. Willy brags, I did five hundred gross in Providence and seven hundred gross in Boston(35). But as Linda begins calculating his commission, the value rapidly diminishes to roughly two hundred gross on the whole trip(35). Linda sees what is going on but does not confront him. A very similar situation occurs later in their life when she finds out that Willy is no longer on salary, but borrows money every week from Charley. Again she will not confront him. By not confronting Willy in either of these instances, Linda allows him to sink further into his false reality. But Linda makes an even worse mistake that allows for Willys suicide. She acknowledges his suicidal tendencies when she says, He s been trying to kill himself(58). She tells the boys that she has found the rubber hose in the basement, but she still will not confront Willy. Another character who is unable to be straight with Willy is Willys boss Howard Wagner. Howard allows Willy to keep his job, but does not pay him. If he had just fired him right out it would of forced Willy to find a new job. By stringing him along, Howard allows Willy to maintain his fantasy world unchallenged. These are examples of the most negative influences in Willys life simply because they have the ability to help but choose not to. It seems that the only people who want to help Willy, are those who he least listens to. In fact the two best influences on Willy come from the same family. Bernard grew up with Biff and Happy but chose a much different path. At a key time in Biffs life, Bernard warns I he doesnt buckle down hell flunk(40). In this scene Bernard is trying to tell Willy that he is instilling the wrong values in his sons who are destined for failure. Willy however does not want to listen to Bernard because he has the most popular and athletic son in town. But even later when Willy sees Bernards success he will not listen. Bernard sees that Willy is still holding on to a job that is not working for him and tells him sometimes, Willy, its just better for a man to walk away(95). Willy can only respond by asking But if you cant walk away?(95). Charley, Bernards father, even takes trying to help Willy a step farther. Charley sees early on that Willys job is not working out and begins offering him a job. Cha rley continues to offer this job until the end. And even though Willy refuses to take a job from Charley, Charley continues to loan Willy the money he needs every week knowing he will never get paid back. In this play Charley and Bernard are the only characters from the beginning to the end that truly do everything they can to help Willy; yet still Willy refuses to listen to them. Because Willy does not want to listen to the outside world, he is forced to create his own sources of guidance. This guidance comes in the form of Ben his brother and Dave Singleman. Ben appears to the audience in the form of Willys flashbacks. He excites Willy with tales of self-made fortune. Willy uses Ben as a scapegoat in order to explain his own failures. He makes himself believe that if he had gone with Ben, he too would be rich. By doing this he avoids facing his own failures as a salesmen. Though we never see Dave Singleman, he is the single most powerful influence on Willy. He is Willys personification of the perfect salesman. Willy hopes to gain the respect and success that Dave Singleman had. But in reality Dave represents the superficiality, which Willy bases his life on. All of the good qualities that Dave Singleman possessed were superficial. Nothing is said about his family life or character. Willy needs to realize that it is the inner qualities that count. By creating a mold of the ideal man in his head, Willy sets himself up for disappointment. When he is unable to be the ideal man he wants to be, he looses his will to live and deems himself as a failure. But because he has shut himself off from those around him, no one is able to reach him before it is too late.
Friday, January 17, 2020
Life of the Prophet Jeremiah
More is known of the life of Jeremiah than of any other literary prophet. He began prophesying in the thirteenth year of the reign of King Josiah (1:2; 25:3), i. e. , 627 B. C. , when Jeremiah was but a youth (1:6). Jeremiah was a reluctant prophet, but felt compelled to speak God's word (20:9). He prophesied until after Nebuchadnezzar destroyed Jerusalem in 586 B. C. (39:1-10; 43:7-8; 44:1), and his ministry lasted a total of about fifty years. Josiah's great religious reformation came in the early part of Jeremiah's work (cf. Kings chapters 22-23), but the reforms did not reach the hearts of the people, for they were still rebellious (25:1-7). The Jews opposed Jeremiah and his work from the very outset. First, the citizens of his native Anathoth tried to stop his work and even attempted to kill him (11:18-23). Even his kinsmen opposed him (12:6). Jeremiah later moved to Jerusalem, but he endured inveterate opposition there also. When King Josiah died, Jeremiah lamented his death (2 Chron. 35:25). Jeremiah prophesied against Josiah's wicked successors: Jehoahaz (also called ââ¬Å"Shallumâ⬠) (22:11-17), Jehoiakim (22:18-19), and Jeconiah (i. . , Coniah or Jehoiachin) (22:24- In the very year Nebuchadnezzar came against Jerusalem, Jeremiah announced both his coming and the seventy year captivity of the Jews (25:1-14). Under the rule of Jehoiakim, Jeremiah preached a great sermon in the temple in Jerusalem (chapters 7-9). After this the princes, prophets, and priests of Judah called for his death (26:8-11). However, Jeremiah was delivered at that time (26:24). At the Lord's direction, Jeremiah dictated his prophecies to Baruch, who wrote them on a scroll (36:1-8). However, when King Jehoiakim read the scroll, he was so angry he cut it with a scribe's knife and threw it into the fire (36:20-25). The king commanded that Jeremiah and Baruch be seized, but the Lord hid them (36:26). Jeremiah dictated the prophecies to Baruch again and added others (36:27-32). Jeremiah urged King Zedekiah to be faithful to Nebuchadnezzar, but Zedekiah refused (27:12-22). The Babylonians besieged Jerusalem, and great suffering resulted. Later, Jeremiah was accused of trying to defect to the enemy and was placed in prison (37:11-15). Subsequently the king transferred him from the dungeon to the court of the prison and gave him a daily ration of bread (37:17-21). When Jeremiah again prophesied against Jerusalem, the king turned him over to the princes, who threw him into a dungeon, the bottom of which was filled with mud, into which Jeremiah sank (38:1-6). Jeremiah would have died there, had he not been rescued by Ebed-Melech, an Ethiopian eunuch of the king's house (38:7-13). When Nebuchadnezzar took Jerusalem, he let Jeremiah go free to his own home (39:11-14). A mutinous band of Jews murdered Gedaliah, who had been appointed governor by Nebuchadnezzar (41:1-3). They decided to flee to Egypt for safety, taking Jeremiah with them as a hostage (43:1-7). They took Jeremiah to Tahpanes in Egypt, where he continued to prophesy against them (43:8 ââ¬â 44:1). The life of Jeremiah was one of sorrow upon sorrow. His people whom he loved and with whom he pleaded unceasingly for fifty years continually refused to hear him, rewarded his labor with rejection and persecution, and eventually perished as the result.
Thursday, January 9, 2020
Cloning and Expressing of Aryl Alcohol Oxidase - Free Essay Example
Sample details Pages: 3 Words: 862 Downloads: 6 Date added: 2019/08/08 Category Science Essay Level High school Tags: Cloning Essay Did you like this example? Abstract: Cellulose fuel ethanol does great significance on solving the energy crisis and reducing environment pollution. However, in the process of industrially degrading cellulose into ethanol, it is difficult to directly degrade the cellulose because of the presence of the lignin barrier. While the aryl alcohol oxidase is responsible for providing H2O2 to initiate the enzymatic reaction of lignin peroxiadase and manganese peroxidase in the lignin degradation system of white rot fungi. Donââ¬â¢t waste time! Our writers will create an original "Cloning and Expressing of Aryl Alcohol Oxidase" essay for you Create order In this study, we obtained the cDNA of aryl alcohol oxidase by obtaining the white fungi RNA and then carrying out reverse transcription method, and transforming it into Pichia pastoris for heterologous expression to collect aryl alcohol oxidase. Subsequent purification was performed for further use. Key Words: white rot fungi; aryl alcohol oxidase; Pichia pastoris Introduction Because of the decreasing of oil production and Greenhouse Effect, people turn to new energy while one of them is cellulose fuel ethanol. [1][2] However, several challenges occur during the catalytic process from cellulose to alcohol. One of the challenges is what we call ââ¬Å"lignin barrierâ⬠, which is a network around the cellulose composed of lignin and hemicellulose by covalent bond.[3] The existence of lignin barrier will hinder the contact between cellulose and its catalyst. Meanwhile, an enzyme system from white rot fungi which can degrade the lignin barrier efficiently has been reported.[3] This enzyme system contains several enzymes like laccase(Lac), manganese peroxidase(MnP), lignin peroxidase(LiP), aryl alcohol oxidase(AAO), etc.[3][4] The function of AAO is to provide H2O2 to start the reaction catalyzed by MnP or LiP.[5][6] One characteristic of AAO is that is can oxidize alcohol to aldehyde.[7] In our study, we cloned the gene of AAO and transformed it into Pich ia pastoris which is suitable host to express exogenous gene. Then we cultivate the yeast and detect the enzymatic activity every day. When the enzymatic activity peaked, we separated AAO from formented liquid and purified it by dialysis and anion exchange resin. We then calculated the output and enzymatic activity of our AAO and compared it with the nature one to find that whether the expression and enzymatic activity of exogenous AAO gene is remarkable to be used in industry or not. Results Obtain the AAO Gene Fig.1 Blast analysis of AAO gene we obtained. The first one is hypothesis so it is excluded. The second one is AAO gene and the similarity between is 98%. By inverse transcription and polymerase chain reaction (PCR) we can get the sequence of AAO. We can draw the conclusion the we successfully obtained the AAO genes using Blast analysis (Fig.1). Analysis of AAO cds Fig.2 Amino acid sequence of AAO cds.. Using Expasy to translate our AAO cds we can draw the amino acid sequence of AAO. Message we can gain from the amino acid sequence is that AAO is composed of 593 amino acids and its molecular weight is 63683.40. By analyzing its amino acid sequence we can learn more about its spatial structure and how it works. Enzymatic Activity Material and Methods Obtain the AAO Gene First, we had used the Trizol method to obtain all the RNA of Pleurotus ostreatus BP3, one kind of white rot fungi. The we degraded it by applying RNase and obtained the AAO RNA sequence by electrophoresis. After that the AAO DNA sequence was obtained by inverse transcription and was amplified by PCR. Formulation and Transformation of the Plasmid Carrier Fig.2 Anticipated formulation of plasmid carrier. AOX1 promoter only can be activated by methyl alcohol so we can control the start of AAO expression. CYC1 terminator is used to stop the expression. Before and after AAO sequence there are two restriction sites for EcoR 1 and Xba 1. We use pPICZ?A plasmid for our formulation. First, we use EcoR 1 and Xba 1 for a double-restriction on the plasmid. Then we can ligate AAO DNA sequence to both ends by a Vazyme kit during PCR. [8] The primer is designed as: HAAO-F? AGAGAGGCTGAAGCTGAATTCAACCTCCCAACCGCTGATTTTGATTA HAAO-R? GAGATGAGTTTTTGTTCTAGACTACTGATCAGCCTTAATAAGATCGGC After that the pPICZ?A-AAO plasmid was transformed into Pichia pastoris and was expressed as exogenous gene. Detection of Enzymatic Activity The enzymatic activity was calculated according to a reaction catalyzed by AAO from mannitol to mannuronate. The latter owns a absorption peak at 330 nm.[9] The absorption of this reaction system at 330nm is monitored by an ELIASA and according to its variation we can get a slope. The enzymatic activity should be inferred by this equation[9]: enzymatic activity?U/L?=(slopeÃâ"10^6 Ãâ"0.2 )/(9300 Ãâ"0.625 Ãâ"0.01 ) In this equation, 0.2 stands for the volume of reaction system (0.2ml), 9300 equals 9300M-1cm-1?, 0.625 means the optical path is 0.625cm and 0.01 is the volume of liquid which is used for ELIASA to detect. Discussion and Conclusion From the final enzymatic activity we can draw the conclusion that the output and enzymatic activity of exogenous AAO gene is similar to/better than nature white rot fungi.[10] For this reason, we can deem that our idea to express AAO in Pichia pastoris is feasible to be apply to industry in order to degrade the lignin barrier. That will directly lead to the progression of efficient to catalyze cellulose to alcohol. Acknowledgements This study is supported by my tutor Dr.Wang and my senior Miss.Gong.
Subscribe to:
Posts (Atom)