Saturday, January 25, 2020
Isolation in Death of a Salesman
Isolation in Death of a Salesman Arthur Millers play Death of a Salesman is the story of a man, Willy Loman, gone deaf to the outside world. Though many try to help him, he shuts them out and creates his own reality in which he is successful and loved by everyone. In Death of a Salesman, Willy has many influences both good and bad attempting to direct his life; it is his refusal to choose the helpful advice that will ultimately lead to his downfall. One negative influence in Willys life is the inability of his friends to confront him about his problems. It is Willys wife that causes him the most harm. In her vain attempt to protect Willy, she actually allows his eventual death. The first sign of her negligence comes in one of Willys flashbacks. Willy brags, I did five hundred gross in Providence and seven hundred gross in Boston(35). But as Linda begins calculating his commission, the value rapidly diminishes to roughly two hundred gross on the whole trip(35). Linda sees what is going on but does not confront him. A very similar situation occurs later in their life when she finds out that Willy is no longer on salary, but borrows money every week from Charley. Again she will not confront him. By not confronting Willy in either of these instances, Linda allows him to sink further into his false reality. But Linda makes an even worse mistake that allows for Willys suicide. She acknowledges his suicidal tendencies when she says, He s been trying to kill himself(58). She tells the boys that she has found the rubber hose in the basement, but she still will not confront Willy. Another character who is unable to be straight with Willy is Willys boss Howard Wagner. Howard allows Willy to keep his job, but does not pay him. If he had just fired him right out it would of forced Willy to find a new job. By stringing him along, Howard allows Willy to maintain his fantasy world unchallenged. These are examples of the most negative influences in Willys life simply because they have the ability to help but choose not to. It seems that the only people who want to help Willy, are those who he least listens to. In fact the two best influences on Willy come from the same family. Bernard grew up with Biff and Happy but chose a much different path. At a key time in Biffs life, Bernard warns I he doesnt buckle down hell flunk(40). In this scene Bernard is trying to tell Willy that he is instilling the wrong values in his sons who are destined for failure. Willy however does not want to listen to Bernard because he has the most popular and athletic son in town. But even later when Willy sees Bernards success he will not listen. Bernard sees that Willy is still holding on to a job that is not working for him and tells him sometimes, Willy, its just better for a man to walk away(95). Willy can only respond by asking But if you cant walk away?(95). Charley, Bernards father, even takes trying to help Willy a step farther. Charley sees early on that Willys job is not working out and begins offering him a job. Cha rley continues to offer this job until the end. And even though Willy refuses to take a job from Charley, Charley continues to loan Willy the money he needs every week knowing he will never get paid back. In this play Charley and Bernard are the only characters from the beginning to the end that truly do everything they can to help Willy; yet still Willy refuses to listen to them. Because Willy does not want to listen to the outside world, he is forced to create his own sources of guidance. This guidance comes in the form of Ben his brother and Dave Singleman. Ben appears to the audience in the form of Willys flashbacks. He excites Willy with tales of self-made fortune. Willy uses Ben as a scapegoat in order to explain his own failures. He makes himself believe that if he had gone with Ben, he too would be rich. By doing this he avoids facing his own failures as a salesmen. Though we never see Dave Singleman, he is the single most powerful influence on Willy. He is Willys personification of the perfect salesman. Willy hopes to gain the respect and success that Dave Singleman had. But in reality Dave represents the superficiality, which Willy bases his life on. All of the good qualities that Dave Singleman possessed were superficial. Nothing is said about his family life or character. Willy needs to realize that it is the inner qualities that count. By creating a mold of the ideal man in his head, Willy sets himself up for disappointment. When he is unable to be the ideal man he wants to be, he looses his will to live and deems himself as a failure. But because he has shut himself off from those around him, no one is able to reach him before it is too late.
Friday, January 17, 2020
Life of the Prophet Jeremiah
More is known of the life of Jeremiah than of any other literary prophet. He began prophesying in the thirteenth year of the reign of King Josiah (1:2; 25:3), i. e. , 627 B. C. , when Jeremiah was but a youth (1:6). Jeremiah was a reluctant prophet, but felt compelled to speak God's word (20:9). He prophesied until after Nebuchadnezzar destroyed Jerusalem in 586 B. C. (39:1-10; 43:7-8; 44:1), and his ministry lasted a total of about fifty years. Josiah's great religious reformation came in the early part of Jeremiah's work (cf. Kings chapters 22-23), but the reforms did not reach the hearts of the people, for they were still rebellious (25:1-7). The Jews opposed Jeremiah and his work from the very outset. First, the citizens of his native Anathoth tried to stop his work and even attempted to kill him (11:18-23). Even his kinsmen opposed him (12:6). Jeremiah later moved to Jerusalem, but he endured inveterate opposition there also. When King Josiah died, Jeremiah lamented his death (2 Chron. 35:25). Jeremiah prophesied against Josiah's wicked successors: Jehoahaz (also called ââ¬Å"Shallumâ⬠) (22:11-17), Jehoiakim (22:18-19), and Jeconiah (i. . , Coniah or Jehoiachin) (22:24- In the very year Nebuchadnezzar came against Jerusalem, Jeremiah announced both his coming and the seventy year captivity of the Jews (25:1-14). Under the rule of Jehoiakim, Jeremiah preached a great sermon in the temple in Jerusalem (chapters 7-9). After this the princes, prophets, and priests of Judah called for his death (26:8-11). However, Jeremiah was delivered at that time (26:24). At the Lord's direction, Jeremiah dictated his prophecies to Baruch, who wrote them on a scroll (36:1-8). However, when King Jehoiakim read the scroll, he was so angry he cut it with a scribe's knife and threw it into the fire (36:20-25). The king commanded that Jeremiah and Baruch be seized, but the Lord hid them (36:26). Jeremiah dictated the prophecies to Baruch again and added others (36:27-32). Jeremiah urged King Zedekiah to be faithful to Nebuchadnezzar, but Zedekiah refused (27:12-22). The Babylonians besieged Jerusalem, and great suffering resulted. Later, Jeremiah was accused of trying to defect to the enemy and was placed in prison (37:11-15). Subsequently the king transferred him from the dungeon to the court of the prison and gave him a daily ration of bread (37:17-21). When Jeremiah again prophesied against Jerusalem, the king turned him over to the princes, who threw him into a dungeon, the bottom of which was filled with mud, into which Jeremiah sank (38:1-6). Jeremiah would have died there, had he not been rescued by Ebed-Melech, an Ethiopian eunuch of the king's house (38:7-13). When Nebuchadnezzar took Jerusalem, he let Jeremiah go free to his own home (39:11-14). A mutinous band of Jews murdered Gedaliah, who had been appointed governor by Nebuchadnezzar (41:1-3). They decided to flee to Egypt for safety, taking Jeremiah with them as a hostage (43:1-7). They took Jeremiah to Tahpanes in Egypt, where he continued to prophesy against them (43:8 ââ¬â 44:1). The life of Jeremiah was one of sorrow upon sorrow. His people whom he loved and with whom he pleaded unceasingly for fifty years continually refused to hear him, rewarded his labor with rejection and persecution, and eventually perished as the result.
Thursday, January 9, 2020
Cloning and Expressing of Aryl Alcohol Oxidase - Free Essay Example
Sample details Pages: 3 Words: 862 Downloads: 6 Date added: 2019/08/08 Category Science Essay Level High school Tags: Cloning Essay Did you like this example? Abstract: Cellulose fuel ethanol does great significance on solving the energy crisis and reducing environment pollution. However, in the process of industrially degrading cellulose into ethanol, it is difficult to directly degrade the cellulose because of the presence of the lignin barrier. While the aryl alcohol oxidase is responsible for providing H2O2 to initiate the enzymatic reaction of lignin peroxiadase and manganese peroxidase in the lignin degradation system of white rot fungi. Donââ¬â¢t waste time! Our writers will create an original "Cloning and Expressing of Aryl Alcohol Oxidase" essay for you Create order In this study, we obtained the cDNA of aryl alcohol oxidase by obtaining the white fungi RNA and then carrying out reverse transcription method, and transforming it into Pichia pastoris for heterologous expression to collect aryl alcohol oxidase. Subsequent purification was performed for further use. Key Words: white rot fungi; aryl alcohol oxidase; Pichia pastoris Introduction Because of the decreasing of oil production and Greenhouse Effect, people turn to new energy while one of them is cellulose fuel ethanol. [1][2] However, several challenges occur during the catalytic process from cellulose to alcohol. One of the challenges is what we call ââ¬Å"lignin barrierâ⬠, which is a network around the cellulose composed of lignin and hemicellulose by covalent bond.[3] The existence of lignin barrier will hinder the contact between cellulose and its catalyst. Meanwhile, an enzyme system from white rot fungi which can degrade the lignin barrier efficiently has been reported.[3] This enzyme system contains several enzymes like laccase(Lac), manganese peroxidase(MnP), lignin peroxidase(LiP), aryl alcohol oxidase(AAO), etc.[3][4] The function of AAO is to provide H2O2 to start the reaction catalyzed by MnP or LiP.[5][6] One characteristic of AAO is that is can oxidize alcohol to aldehyde.[7] In our study, we cloned the gene of AAO and transformed it into Pich ia pastoris which is suitable host to express exogenous gene. Then we cultivate the yeast and detect the enzymatic activity every day. When the enzymatic activity peaked, we separated AAO from formented liquid and purified it by dialysis and anion exchange resin. We then calculated the output and enzymatic activity of our AAO and compared it with the nature one to find that whether the expression and enzymatic activity of exogenous AAO gene is remarkable to be used in industry or not. Results Obtain the AAO Gene Fig.1 Blast analysis of AAO gene we obtained. The first one is hypothesis so it is excluded. The second one is AAO gene and the similarity between is 98%. By inverse transcription and polymerase chain reaction (PCR) we can get the sequence of AAO. We can draw the conclusion the we successfully obtained the AAO genes using Blast analysis (Fig.1). Analysis of AAO cds Fig.2 Amino acid sequence of AAO cds.. Using Expasy to translate our AAO cds we can draw the amino acid sequence of AAO. Message we can gain from the amino acid sequence is that AAO is composed of 593 amino acids and its molecular weight is 63683.40. By analyzing its amino acid sequence we can learn more about its spatial structure and how it works. Enzymatic Activity Material and Methods Obtain the AAO Gene First, we had used the Trizol method to obtain all the RNA of Pleurotus ostreatus BP3, one kind of white rot fungi. The we degraded it by applying RNase and obtained the AAO RNA sequence by electrophoresis. After that the AAO DNA sequence was obtained by inverse transcription and was amplified by PCR. Formulation and Transformation of the Plasmid Carrier Fig.2 Anticipated formulation of plasmid carrier. AOX1 promoter only can be activated by methyl alcohol so we can control the start of AAO expression. CYC1 terminator is used to stop the expression. Before and after AAO sequence there are two restriction sites for EcoR 1 and Xba 1. We use pPICZ?A plasmid for our formulation. First, we use EcoR 1 and Xba 1 for a double-restriction on the plasmid. Then we can ligate AAO DNA sequence to both ends by a Vazyme kit during PCR. [8] The primer is designed as: HAAO-F? AGAGAGGCTGAAGCTGAATTCAACCTCCCAACCGCTGATTTTGATTA HAAO-R? GAGATGAGTTTTTGTTCTAGACTACTGATCAGCCTTAATAAGATCGGC After that the pPICZ?A-AAO plasmid was transformed into Pichia pastoris and was expressed as exogenous gene. Detection of Enzymatic Activity The enzymatic activity was calculated according to a reaction catalyzed by AAO from mannitol to mannuronate. The latter owns a absorption peak at 330 nm.[9] The absorption of this reaction system at 330nm is monitored by an ELIASA and according to its variation we can get a slope. The enzymatic activity should be inferred by this equation[9]: enzymatic activity?U/L?=(slopeÃâ"10^6 Ãâ"0.2 )/(9300 Ãâ"0.625 Ãâ"0.01 ) In this equation, 0.2 stands for the volume of reaction system (0.2ml), 9300 equals 9300M-1cm-1?, 0.625 means the optical path is 0.625cm and 0.01 is the volume of liquid which is used for ELIASA to detect. Discussion and Conclusion From the final enzymatic activity we can draw the conclusion that the output and enzymatic activity of exogenous AAO gene is similar to/better than nature white rot fungi.[10] For this reason, we can deem that our idea to express AAO in Pichia pastoris is feasible to be apply to industry in order to degrade the lignin barrier. That will directly lead to the progression of efficient to catalyze cellulose to alcohol. Acknowledgements This study is supported by my tutor Dr.Wang and my senior Miss.Gong.
Subscribe to:
Comments (Atom)